Amazin-A

Just some generic pony in a hoodie sleeping in a generic bed with a generic sequence of a generic dismembered dick cock slapping some sleeping hooves I mean sheesh what the fuck did you think it was. 

art amazin a pony hooves cum

1. bobcahil liked this
2. likuem liked this
3. omg-mr-skelleton-posts liked this
4. lefthalftimeshark liked this
5. alderfasorm liked this
6. wing-pony liked this
7. coolmlp13 liked this
8. ariel-celestia liked this
9. catcatcatcatcatcatcatcatcatcatca liked this
10. pornstorage34 liked this
11. dookin-foof-lord liked this
12. askbluecrescentmoon liked this
13. thatgreypegasus liked this
14. vocal-point liked this
15. codyclopsalot liked this
16. dragomatic liked this
17. jackvladimeirreikov liked this
18. cutiebitchyqueen liked this
19. pisces-kelp liked this
20. ask-fireandrose liked this
21. undeadparadox liked this
22. thedreamer148 liked this
23. trytostayintheframe liked this
24. justnarelynormal liked this
25. 570rm-r4nn3r liked this
26. theimpresster859 liked this
27. nikitabrony1 liked this
28. alexi148 liked this
29. lvnnkartistries reblogged this from amazin-arts and added:

    Lucky cock :V

30. awesome-twelve-from-tlk liked this
31. theidledrifter liked this
32. nightstar700 liked this
33. nightstar800 reblogged this from amazin-arts
34. hispushkaa liked this
35. voidof liked this
36. sparde liked this
37. neoncel-nsfw liked this
38. coolycool liked this
39. theswegbucket said: Absolutely love the foot/Hoof drawings
40. theswegbucket liked this
41. smileybomb liked this
42. taloverae liked this
43. feeling-just-peachy liked this
44. dirtydaaan liked this
45. amazin-arts posted this
46. Show more notesLoading...